Francais | English | Espanõl

Haplogroup R1b (Y-DNA)

From Wikipedia, the free encyclopedia

(Redirected from R1b)
Jump to: navigation, search

In human genetics, Haplogroup R1b (M343) (previously called Hg1 and Eu18) is the most frequent Y-chromosome haplogroup in Europe.

Its frequency is highest in Western Europe (and due to European emigration, in North America). In southern England the frequency of R1b is about 70% and in parts of Spain, Portugal, France, Wales and Ireland, the frequency of R1b is as high as 90%.

Contents

[edit] Subclades

Haplogroup R1b is a descendant of Haplogroup R1 (M173). R1b is characterised by the presence of the M343 marker.

  • R1b (M343)
    • R1b1 (P25)
      • R1b1a (M18)
      • R1b1b (M73)
      • R1b1c (M269, S3, S10, S13, S17)
        • R1b1c1 (M37)
        • R1b1c2 (M65)
        • R1b1c3 (M126)
        • R1b1c4 (M153)
        • R1b1c5 (M160)
        • R1b1c6 (SRY2627, M167)
        • R1b1c7 (M222)
        • R1b1c8 (P66)
        • R1b1c9 (S21)
          • R1b1c9a (S26)
          • R1b1c9b (S29)
          • R1b1c9*
        • R1b1c10 (S28)
        • R1b1c*
      • R1b1d (M335)
      • R1b1*
    • R1b*

[edit] R1b1c

Nearly all present-day Europeans with the M343 marker also have the P25 and M269 markers. These markers define the R1b1c subclade.

This subgroup probably originated in Central Asia and is believed by some to have been widespread in Europe before the last Ice Age, and associated with the Aurignacian culture (32,000 - 21,000 BC) of the Cro-Magnon people, the first modern humans to enter Europe. The Cro-Magnons were the first documented human artists, making sophisticated cave paintings. Famous sites include Lascaux in France, Cueva de las Monedas in Spain and Valley of Foz Côa in Portugal (the largest open-air site in Europe). It is well to recall, however, that the identification of Y-haplogroup R1b with the Cro-Magnons of the Aurignacian culture is highly speculative and controversial. It remains unproven.

The glaciation of the ice age intensified, and the continent became increasingly uninhabitable. The genetic diversity narrowed through founder effects and population bottlenecks, as the population became limited to a few coastal refugia in Southern Europe and Asia Minor. The present-day population of R1b in Western Europe are believed to be the descendants of a refugium in the Iberian peninsula (Spain and Portugal), where the R1b1c haplogroup may have achieved genetic homogeneity. As conditions eased with the Allerød Oscillation in about 12,000 BC, descendants of this group migrated and eventually recolonised all of Western Europe, leading to the dominant position of R1b in variant degrees from Iberia to Scandinavia, so evident in haplogroup maps.

The above explanation of the predominance of R1b in Western Europe, like the identification of R1b with the Cro-Magnons of the Aurignacian culture, is highly speculative and controversial. An alternative and equally speculative view is that R1b represents the Western or centum-speaking branch of the Proto-Indo-Europeans.

A second R1b1c population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying Y-STR markers, appear to have survived alongside other haplogroups in Asia Minor, from where they spread out to repopulate Eastern Europe. However, they do not have the same dominance that R1b has in Western Europe. Instead the most common haplogroup in Eastern Europe is haplogroup R1a1, often thought to be associated with a subsequent migration of Indo-Europeans (or perhaps their ancestors) from the East.

(Note that in earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then, for a time (from 2003 to 2005) what is now R1b1c was designated R1b3. This shows how nomenclature can evolve as new markers are discovered and then investigated).

[edit] Other subclades

Populations characterised as R1b1a (M18) and R1b1b (M73) with those mutually exclusive distinctive markers but no M269 have been found, in Sardinia, and in central Asia, respectively. It is presumed that these are descendants of R1b1 populations which found other refuges from the ice.

An apparent R1b1* population has been found among the Ouldeme of Northern Cameroon in west central Africa [1][2].

The R1b1c9a subclade is defined by the S26 SNP, and occurs in less than a half a percent of R1b males. S26 is located in the flanking region of DYS439. When it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or "null 439". For further information, see http://www.familytreedna.com/public/null439 .

[edit] Modal haplotypes

Within the R1b haplogroup are modal haplotypes. One of the best-characterized of these haplotypes is the Atlantic Modal Haplotype (AMH).

[edit] Niall of the Nine Hostages

In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable halpotype of many within the septs associated with Niall of the Nine Hostages, an Irish king in the Dark Ages.

[edit] Relationship to other haplogroups

Human Y-chromosome DNA (Y-DNA) haplogroups

|
Y-MRCA
|
A |
B |
C | F
D E G H | K
I J L M | P
N O Q R
Haplogroup R
Haplogroup R1
Haplogroup R1a

Haplogroup R1a1




Haplogroup R1b




Haplogroup R2




[edit] Technical specification of mutation

The technical details of M343 are:

Nucleotide change: C to A
Position (base pair): 402
Total size (base pairs):424
Forward 5′→3′: tttaacctcctccagctctgca
Reverse 5′→3′: acccccacatatctccagg 

This refers to a particular 424 base-pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.

[edit] See also

[edit] References

[edit] External links

Personal tools